After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Собачий DDX5 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine DDX5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001286941.1
Размер кДНК:1845bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris DEAD (Asp-Glu-Ala-Asp) box helicase 5 with C terminal HA tag.
Синоним гена:DDX5
Виды:Canine
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Собачий DDX5 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Собачий DDX5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70237-ACGRBS16760
Собачий DDX5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70237-ACRRBS16760
Собачий DDX5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаDG70237-ANGRBS16760
Собачий DDX5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаDG70237-ANRRBS16760
Собачий DDX5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70237-CFRBS14710
Собачий DDX5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70237-CHRBS14710
Собачий DDX5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70237-CMRBS14710
Собачий DDX5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70237-CYRBS14710
Собачий DDX5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70237-NFRBS14710
Собачий DDX5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70237-NHRBS14710
Собачий DDX5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70237-NMRBS14710
Собачий DDX5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70237-NYRBS14710
Собачий DDX5 Джин клон кДНК в вектор клонированияDG70237-URBS5130
Собачий DDX5 Джин ORF экспрессии кДНК клона плазмидыDG70237-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: DG70237-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».