After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Собачий CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine CHN1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_845334.3
Размер кДНК:1005bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris chimerin 1 with C terminal His tag.
Синоним гена:CHN1
Виды:Canine
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Собачий CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Собачий CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70211-ACGRBS15400
Собачий CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70211-ACRRBS15400
Собачий CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаDG70211-ANGRBS15400
Собачий CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаDG70211-ANRRBS15400
Собачий CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70211-CFRBS13340
Собачий CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70211-CHRBS13340
Собачий CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70211-CMRBS13340
Собачий CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70211-CYRBS13340
Собачий CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70211-NFRBS13340
Собачий CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70211-NHRBS13340
Собачий CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70211-NMRBS13340
Собачий CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70211-NYRBS13340
Собачий CHN1 / chimerin 1 Джин клон кДНК в вектор клонированияDG70211-URBS5130
Собачий CHN1 / chimerin 1 Джин ORF экспрессии кДНК клона плазмидыDG70211-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CHN1, also known as chimerin 1, is a TPase-activating protein for ras-related p21-rac and a phorbol ester receptor. It is predominantly expressed in neurons, and plays an important role in neuronal signal-transduction mechanisms. CHN1 is involved in the assembly of neuronal locomotor circuits as a direct effector of EPHA4 in axon guidance. The CHN1 gene provides instructions for making two very similar proteins called α1-chimaerin and α2-chimaerin. These proteins play an important role in the early development of the nervous system. In particular, they help regulate complex chemical signaling pathways during the formation and development of nerve cells (neurons). These proteins help guide the growth of axons and dendrites, which are specialized extensions of neurons that transmit and receive nerve impulses throughout the nervous system.

Ссылки
  • Miyake N. et al, 2010, Am J Med Genet A. 152 (1): 215-7.
  • Miyake N. et al., 2011, Invest Ophthalmol Vis Sci. 52 (9): 6321-8.
  • Volk AE. et al., 2010, Graefes Arch Clin Exp Ophthalmol. 248 (9): 1351-7.
  • Size / Price
    Каталог: DG70211-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».