After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Собачий Cadherin-11/OB-Cadherin Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine CDH11 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_536826.3
Размер кДНК:2391bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris cadherin 11, type 2, OB-cadherin (osteoblast) with C terminal Flag tag.
Синоним гена:CDH11
Виды:Canine
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Собачий Cadherin-11/OB-Cadherin Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Собачий Cadherin-11/OB-Cadherin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70023-ACGRBS16760
Собачий Cadherin-11/OB-Cadherin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70023-ACRRBS16760
Собачий Cadherin-11/OB-Cadherin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70023-CFRBS14710
Собачий Cadherin-11/OB-Cadherin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70023-CHRBS14710
Собачий Cadherin-11/OB-Cadherin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70023-CMRBS14710
Собачий Cadherin-11/OB-Cadherin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70023-CYRBS14710
Собачий Cadherin-11/OB-Cadherin Джин клон кДНК в вектор клонированияDG70023-GRBS5130
Собачий Cadherin-11/OB-Cadherin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70023-NFRBS14710
Собачий Cadherin-11/OB-Cadherin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70023-NHRBS14710
Собачий Cadherin-11/OB-Cadherin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70023-NMRBS14710
Собачий Cadherin-11/OB-Cadherin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70023-NYRBS14710
Собачий Cadherin-11/OB-Cadherin Джин ORF экспрессии кДНК клона плазмидыDG70023-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».