Быстрый заказ

Собачий CCL5/RANTES Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine CCL5 Информация о продукте «Клон cDNA»
Размер кДНК:276bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris chemokine (C-C motif) ligand 5 with C terminal Flag tag.
Синоним гена:RANTES
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Собачий CCL5/RANTES Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Собачий CCL5/RANTES Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70007-ACGRBS15396
Собачий CCL5/RANTES Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70007-ACRRBS15396
Собачий CCL5/RANTES Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70007-CFRBS13343
Собачий CCL5/RANTES Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70007-CHRBS13343
Собачий CCL5/RANTES Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70007-CMRBS13343
Собачий CCL5/RANTES Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70007-CYRBS13343
Собачий CCL5/RANTES Джин клон кДНК в вектор клонированияDG70007-MRBS5132
Собачий CCL5/RANTES Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70007-NFRBS13343
Собачий CCL5/RANTES Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70007-NHRBS13343
Собачий CCL5/RANTES Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70007-NMRBS13343
Собачий CCL5/RANTES Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70007-NYRBS13343
Собачий CCL5/RANTES Джин ORF экспрессии кДНК клона плазмидыDG70007-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the same structure similarities such as small size, and the presence of four cysteine residues in conserved locations in order to form their 3-dimensional shape. Some of the chemokines are considered pro-inflammatory which can be induced to recruit cells of the immune system to a site of infection during an immune response, while others are considered homeostatic and are implied in controlling the migration of cells during normal processes of tissue maintenance and development. There are four members of the chemokine family: C-C kemokines, C kemokines, CXC kemokines and CX3C kemokines. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands-1 to 28. Chemokin ligand 5(CCL5) is chemotactic for T cells, basophils and eosinophils. Chemokin ligand 5(CCL5) has been considered a HIV-supressor secreted by CD8+ T cells and other immune cells. Chemokin ligand 5(CCL5) is a key to activating recruit leukocytes into inflammatory sites and in the presence of particular cytokines released by T cells, it can change the NK cells into CHAK cells.

  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28(5): 443-60.
  • Cocchi F, et al. (1995) Identification of RANTES, MIP-1a, and MIP-1b as the major HIV-suppressive factor produced by CD8+ T cells. Science. 270 (5243): 1811-5.
  • Vangelista L, et al. (2010) Engineering of Lactobacillus jensenii to secrete RANTES and a CCR5 antagonist analogue as live HIV-1 blockers. Antimicrob. Agents Chemother. 54 (7): 2994-3001.
  • Maghazachi AA, et al. (1996) CC chemokines induce the generation of killer cells from CD56+ cells. Eur. J. Immunol. 26 (2): 315-9.
  • Size / Price
    Каталог: DG70007-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.