Быстрый заказ

Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine C12H6orf57 Информация о продукте «Клон cDNA»
Размер кДНК:324bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris chromosome 12 open reading frame, human C6orf57 with C terminal His tag.
Синоним гена:C12H6orf57
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70195-ACGRBS15400
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70195-ACRRBS15400
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаDG70195-ANGRBS15400
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаDG70195-ANRRBS15400
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70195-CFRBS13340
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70195-CHRBS13340
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70195-CMRBS13340
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70195-CYRBS13340
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70195-NFRBS13340
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70195-NHRBS13340
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70195-NMRBS13340
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70195-NYRBS13340
Собачий C12H6orf57 Джин клон кДНК в вектор клонированияDG70195-URBS5130
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмидыDG70195-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: DG70195-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.