After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine C12H6orf57 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_848461.3
Размер кДНК:324bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris chromosome 12 open reading frame, human C6orf57 with C terminal His tag.
Синоним гена:C12H6orf57
Виды:Canine
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70195-ACGRBS15400
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70195-ACRRBS15400
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаDG70195-ANGRBS15400
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаDG70195-ANRRBS15400
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70195-CFRBS13340
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70195-CHRBS13340
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70195-CMRBS13340
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70195-CYRBS13340
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70195-NFRBS13340
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70195-NHRBS13340
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70195-NMRBS13340
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70195-NYRBS13340
Собачий C12H6orf57 Джин клон кДНК в вектор клонированияDG70195-URBS5130
Собачий C12H6orf57 Джин ORF экспрессии кДНК клона плазмидыDG70195-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: DG70195-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».