After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Собачий BDNF/ANON2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine BDNF Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001002975.1
Размер кДНК:744bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris brain-derived neurotrophic factor with C terminal Flag tag.
Синоним гена:BDNF
Виды:Canine
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Собачий BDNF/ANON2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Собачий BDNF/ANON2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70029-ACGRBS15400
Собачий BDNF/ANON2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70029-ACRRBS15400
Собачий BDNF/ANON2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70029-CFRBS13340
Собачий BDNF/ANON2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70029-CHRBS13340
Собачий BDNF/ANON2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70029-CMRBS13340
Собачий BDNF/ANON2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70029-CYRBS13340
Собачий BDNF/ANON2 Джин клон кДНК в вектор клонированияDG70029-GRBS5130
Собачий BDNF/ANON2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70029-NFRBS13340
Собачий BDNF/ANON2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70029-NHRBS13340
Собачий BDNF/ANON2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70029-NMRBS13340
Собачий BDNF/ANON2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70029-NYRBS13340
Собачий BDNF/ANON2 Джин ORF экспрессии кДНК клона плазмидыDG70029-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

BDNF is a member of the nerve growth factor family. It is highly expressed in hippocampus, amygdala, cerebral cortex and cerebellum. It also can be detected in heart, lung, skeletal muscle, testis, prostate and placenta. BDNF is induced by cortical neurons, and is necessary for survival of striatal neurons in the brain. During development, BDNF promotes the survival and differentiation of selected neuronal populations of the peripheral and central nervous systems. It participates in axonal growth, pathfinding and in the modulation of dendritic growth and morphology. It functions as the major regulator of synaptic transmission and plasticity at adult synapses in many regions of the CNS. The versatility of BDNF is emphasized by its contribution to a range of adaptive neuronal responses including long-term potentiation (LTP), long-term depression (LTD), certain forms of short-term synaptic plasticity, as well as homeostatic regulation of intrinsic neuronal excitability.

Ссылки
  • Zigova T, et al. (1998) Intraventricular administration of BDNF increases the number of newly generated neurons in the adult olfactory bulb. Mol Cell Neurosci. 11(4):234-45.
  • Acheson A, et al. (1995) A BDNF autocrine loop in adult sensory neurons prevents cell death. Nature 374(6521):450-3.
  • Bekinschtein P, et al. (2008) BDNF is essential to promote persistence of long-term memory storage. Proc Natl Acad Sci. 105(7):2711-6.
  • Size / Price
    Каталог: DG70029-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».