Быстрый заказ

Собачий ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine ATP6V1B2 Информация о продукте «Клон cDNA»
Размер кДНК:1536bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 with C terminal HA tag.
Синоним гена:ATP6V1B2
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Собачий ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Собачий ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70240-ACGRBS16760
Собачий ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70240-ACRRBS16760
Собачий ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаDG70240-ANGRBS16760
Собачий ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаDG70240-ANRRBS16760
Собачий ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70240-CFRBS14710
Собачий ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70240-CHRBS14710
Собачий ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70240-CMRBS14710
Собачий ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70240-CYRBS14710
Собачий ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70240-NFRBS14710
Собачий ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70240-NHRBS14710
Собачий ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70240-NMRBS14710
Собачий ATP6V1B2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70240-NYRBS14710
Собачий ATP6V1B2 Джин клон кДНК в вектор клонированияDG70240-URBS5130
Собачий ATP6V1B2 Джин ORF экспрессии кДНК клона плазмидыDG70240-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: DG70240-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.