Быстрый заказ

Собачий ANGPTL7/Angiopoietin-like 7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine ANGPTL7 Информация о продукте «Клон cDNA»
Размер кДНК:1035bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris angiopoietin-like 7 with C terminal Flag tag.
Синоним гена:ANGPTL7
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Собачий ANGPTL7/Angiopoietin-like 7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Собачий ANGPTL7/Angiopoietin-like 7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70030-ACGRBS15400
Собачий ANGPTL7/Angiopoietin-like 7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70030-ACRRBS15400
Собачий ANGPTL7/Angiopoietin-like 7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70030-CFRBS13340
Собачий ANGPTL7/Angiopoietin-like 7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70030-CHRBS13340
Собачий ANGPTL7/Angiopoietin-like 7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70030-CMRBS13340
Собачий ANGPTL7/Angiopoietin-like 7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70030-CYRBS13340
Собачий ANGPTL7/Angiopoietin-like 7 Джин клон кДНК в вектор клонированияDG70030-GRBS5130
Собачий ANGPTL7/Angiopoietin-like 7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70030-NFRBS13340
Собачий ANGPTL7/Angiopoietin-like 7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70030-NHRBS13340
Собачий ANGPTL7/Angiopoietin-like 7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70030-NMRBS13340
Собачий ANGPTL7/Angiopoietin-like 7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70030-NYRBS13340
Собачий ANGPTL7/Angiopoietin-like 7 Джин ORF экспрессии кДНК клона плазмидыDG70030-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: DG70030-CF
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.