After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Собачий Angiopoietin-2/ANG2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine ANGPT2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001048126.1
Размер кДНК:1488bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris angiopoietin 2 with C terminal Flag tag.
Синоним гена:ANG-2, ANGPT2
Виды:Canine
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Собачий Angiopoietin-2/ANG2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Собачий Angiopoietin-2/ANG2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70034-ACGRBS15400
Собачий Angiopoietin-2/ANG2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70034-ACRRBS15400
Собачий Angiopoietin-2/ANG2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70034-CFRBS13340
Собачий Angiopoietin-2/ANG2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70034-CHRBS13340
Собачий Angiopoietin-2/ANG2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70034-CMRBS13340
Собачий Angiopoietin-2/ANG2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70034-CYRBS13340
Собачий Angiopoietin-2/ANG2 Джин клон кДНК в вектор клонированияDG70034-GRBS5130
Собачий Angiopoietin-2/ANG2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70034-NFRBS13340
Собачий Angiopoietin-2/ANG2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70034-NHRBS13340
Собачий Angiopoietin-2/ANG2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70034-NMRBS13340
Собачий Angiopoietin-2/ANG2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70034-NYRBS13340
Собачий Angiopoietin-2/ANG2 Джин ORF экспрессии кДНК клона плазмидыDG70034-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Angiopoietin-2 (ANG 2, or ANGPT2), is a member of the ANG family, which plays an important role in angiogenesis during the development and growth of human cancers. Both ANGPT-1 and ANGPT-2 appear to bind to the tyrosine kinase receptor, Tie-2, found primarily on the luminal surface of endothelial cells. ANG-2's role in angiogenesis generally is considered as an antagonist for ANG1, inhibiting ANG1-promoted Tie2 signaling, which is critical for blood vessel maturation and stabilization. ANG-2 modulates angiogenesis in a cooperative manner with another important angiogenic factor, vascular endothelial growth factor A. Genetic studies have revealed that ANG-2 also is critical in lymphangiogenesis during development. ANG-2 has multiple physiologic effects that regulate vascular tone, hormone secretion, tissue growth and neural activity. Several reports indicate that ANG-2 can induce neovascularization in experimental systems due to the expression of different growth factors such as angiopoietin 2, vascular endothelial factor, and its receptor, fibroblast growth factor, platelet derived growth factor, transforming growth factor beta and epidermal growth factor. In addition, ANG-2 is strongly expressed in the vasculature of many tumors and it has been suggested that ANG-2 may act synergistically with other cytokines such as vascular endothelial growth factor to promote tumor-associated Angiogenesis and tumor progression.

Ссылки
  • Thomas M, et al. (2009) The role of the Angiopoietins in vascular morphogenesis. Angiogenesis. 12(2): 125-37.
  • Hu B, et al. (2009) Angiopoietin-2: development of inhibitors for cancer therapy. Curr Oncol Rep. 11(2): 111-6.
  • Fiedler U, et al. (2006) Angiopoietins: a link between angiogenesis and inflammation. Trends Immunol. 27: 552-8.
  • Escobar E, et al. (2004) Angiotensin II, cell proliferation and angiogenesis regulator: biologic and therapeutic implications in cancer. Curr Vasc Pharmacol. 2(4): 385-99.
  • Size / Price
    Каталог: DG70034-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».