Быстрый заказ

Собачий Aldolase C/ALDOC Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Canine ALDOC Информация о продукте «Клон cDNA»
Размер кДНК:1095bp
Описание кДНК:Full length Clone DNA of Canis lupus familiaris aldolase C, fructose-bisphosphate with C terminal His tag.
Синоним гена:ALDOC
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Собачий Aldolase C/ALDOC Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Собачий Aldolase C/ALDOC Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаDG70204-ACGRBS15400
Собачий Aldolase C/ALDOC Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаDG70204-ACRRBS15396
Собачий Aldolase C/ALDOC Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаDG70204-ANGRBS15400
Собачий Aldolase C/ALDOC Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаDG70204-ANRRBS15396
Собачий Aldolase C/ALDOC Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаDG70204-CFRBS13340
Собачий Aldolase C/ALDOC Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаDG70204-CHRBS13340
Собачий Aldolase C/ALDOC Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаDG70204-CMRBS13340
Собачий Aldolase C/ALDOC Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаDG70204-CYRBS13340
Собачий Aldolase C/ALDOC Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаDG70204-NFRBS13340
Собачий Aldolase C/ALDOC Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаDG70204-NHRBS13340
Собачий Aldolase C/ALDOC Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаDG70204-NMRBS13340
Собачий Aldolase C/ALDOC Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаDG70204-NYRBS13340
Собачий Aldolase C/ALDOC Джин клон кДНК в вектор клонированияDG70204-URBS5132
Собачий Aldolase C/ALDOC Джин ORF экспрессии кДНК клона плазмидыDG70204-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: DG70204-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.