Cadherin 17 / CDH17 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

Cadherin 17 / CDH17 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2484 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus cadherin 17.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

Cadherin 17 / CDH17 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

HPT-1 cDNA ORF Clone, Mouse; HPT-1/LI cDNA ORF Clone, Mouse

Cadherin 17 / CDH17 Background Information

Cadherin-17 or LI-cadherin is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. Cadherin-17/LI-cadherin is a cadherin-like protein consisting of an extracellular region, 7 cadherin domains, and a transmembrane region but lacking the conserved cytoplasmic domain. The protein is a component of the gastrointestinal tract and pancreatic ducts, acting as an intestinal proton-dependent peptide transporter in the first step in oral absorption of many medically important peptide-based drugs. The protein may also play a role in the morphological organization of liver and intestine. Alternative splicing of the encoding gene results in multiple transcript variants. Cadherin-17/LI-cadherin preferentially interact with themselves in a homophilic manner in connecting cells. Cadherin-17 may thus contribute to the sorting of heterogeneous cell types and have a role in the morphological organization of liver and intestine. It's also involved in intestinal peptide transport. Experiments have reported the association between Cadherin-17/LI-cadherin and gastric cancer. Cadherin-17/LI-cadherin expression was detected in 63/94 of gastric adenocarcinomas in addition to intestinal metaplasia. The expression of Cadherin-17 tended to be associated with intestinal type carcinoma, and carcinomas with Cadherin-17 expression was significantly more frequent in advanced stage cases than in early stage. Cadherin-17 is also a useful immunohistochemical marker for diagnosis of adenocarcinomas of the digestive system.
Full Name
cadherin 17, LI cadherin (liver-intestine)
References
  • Liu LX, et al. (2009) Targeting cadherin-17 inactivates Wnt signaling and inhibits tumor growth in liver carcinoma. Hepatology. 50(5): 1453-63.
  • Ito R, et al. (2005) Clinicopathological significant and prognostic influence of cadherin-17 expression in gastric cancer. Virchows Arch. 447(4): 717-22.
  • Horsfield J, et al. (2002) Cadherin-17 is required to maintain pronephric duct integrity during zebrafish development. Mech Dev. 115(1-2): 15-26.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait