After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек IL8Rb/CXCR2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IL8Rb/CXCR2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001557.2
Размер кДНК:1083bp
Описание кДНК:Full length Clone DNA of interleukin 8 receptor, beta with His tag.
Синоним гена:CD182, CXCR2, IL8R2, IL8RA, CMKAR2, CDw128b
Виды:Human
переносчик:pCMV/hygro-His
Plasmid:pCMV-CXCR2-10his
Участок рестрикции:KpnI + XhoI (5.5kb + 1.11kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref.ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human IL8Rb/CXCR2 Gene Plasmid Map
Human CXCR2 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
pCMV/hygro-HIs Vector Information
 
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек IL8Rb/CXCR2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10788-ACGRBS15400
Человек IL8Rb/CXCR2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10788-ACRRBS15400
Человек IL8Rb/CXCR2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10788-ANGRBS15400
Человек IL8Rb/CXCR2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10788-CFRBS13340
Человек IL8Rb/CXCR2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10788-CHRBS13340
Человек IL8Rb/CXCR2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10788-CMRBS13340
Человек IL8Rb/CXCR2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10788-CYRBS13340
Человек IL8Rb/CXCR2 Джин клон кДНК в вектор клонированияHG10788-MRBS5130
Человек IL8Rb/CXCR2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10788-NFRBS13340
Человек IL8Rb/CXCR2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10788-NHRBS13340
Человек IL8Rb/CXCR2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10788-NMRBS13340
Человек IL8Rb/CXCR2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10788-NYRBS13340
Человек IL8Rb/CXCR2 Джин ORF экспрессии кДНК клона плазмидыHG10788-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Contact Us
Изображения
  • Human CXCR2 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
    Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».