After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CLU Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001831.2
Размер кДНК:1506bp
Описание кДНК:Full length Clone DNA of Homo sapiens clusterin with His tag.
Синоним гена:CLI, AAG4, APOJ, KUB1, SGP2, SGP-2, SP-40, TRPM2, TRPM-2, MGC24903, CLU
Виды:Human
переносчик:pCMV/hygro-His
Plasmid:pCMV-CLU-10his
Участок рестрикции:KpnI + XhoI (5.5kb + 1.54kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref.ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human CLU Gene Plasmid Map
Human CLU Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
pCMV/hygro-HIs Vector Information
 
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11297-ACGRBS16760
Человек Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11297-ACRRBS16760
Человек Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11297-CFRBS14710
Человек Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11297-CHRBS14710
Человек Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11297-CMRBS14710
Человек Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11297-CYRBS14710
Человек Clusterin/Apolipoprotein J/Apo-J Джин клон кДНК в вектор клонированияHG11297-MRBS5130
Человек Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11297-NFRBS14710
Человек Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11297-NHRBS14710
Человек Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11297-NMRBS14710
Человек Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11297-NYRBS14710
Человек Clusterin/Apolipoprotein J/Apo-J Джин ORF экспрессии кДНК клона плазмидыHG11297-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Clusterin, also known as complement-associated protein SP-40, Complement cytolysis inhibitor, Apolipoprotein J, Testosterone-repressed prostate message 2, Aging-associated gene 4 protein, CLU and APOJ, is a secreted protein which belongs to the clusterin family. Clusterin/Apolipoprotein J/Apo-J is an enigmatic glycoprotein with a nearly ubiquitous tissue distribution and an apparent involvement in biological processes ranging from mammary gland involution to neurodegeneration in Alzheimer's disease. Its major form, a heterodimer, is secreted and present in physiological fluids, but truncated forms targeted to the nucleus have also been identified. Clusterin/Apolipoprotein J/Apo-J is a widely distributed glycoprotein with a wide range of biologic properties. A prominent and defining feature of clusterin is its marked induction in such disease states as glomerulonephritis, cystic renal disease, renal tubular injury, neurodegenerative conditions, atherosclerosis, and myocardial infarction. Upregulation of clusterin mRNA and protein levels detected in diverse disease states and in in vitro systems have led to suggestions that it functions in membrane lipid recycling, in apoptotic cell death, and as a stress-induced secreted chaperone protein, amongst others.

Ссылки
  • Silkensen JR, et al. (1994) The role of clusterin in tissue injury. Biochem Cell Biol. 72(11-12): 483-8.
  • Naik RR, et al. (2002) Biomimetic synthesis and patterning of silver nanoparticles. Nat Mater. 1(3): 169-72.
  • Djeu JY, et al. (2009) Clusterin and chemoresistance. Adv Cancer Res. 105: 77-92.
  • Contact Us
    Изображения
    • Human CLU Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».