CD70 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10780-M-F

This product is not available, please contact order@sinobiological.com for relevant product if required.

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CD70 Reagents

CRO Services


All CD70 Reagents

CD70 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
582 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human CD70 molecule with Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
KpnI + XbaI (5.4kb + 0.63kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD70 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD70 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

CD27L cDNA ORF Clone, Human;CD27LG cDNA ORF Clone, Human;TNFSF7 cDNA ORF Clone, Human

CD70 Background Information

CD70, a member of the tumor necrosis factor superfamily, is restricted to activated T-and B-lymphocytes and mature dendritic cells. Binding of CD70 to its receptor, CD27, is important in priming, effector functions, differentiation and memory formation of T-cells as well as plasma and memory B-cell generation. Tight control of CD70 expression is required to prevent lethal immunodeficiency. By selective transcription, CD70 is largely confined to activated lymphocytes and dendritic cells (DC). As a type II transmembrane receptor, CD70 is normally expressed on a subset of B, T and NK cells, where it plays a costimulatory role in immune cell activation. Immunohistochemical analysis of CD70 expression in multiple carcinoma types. The restricted expression pattern of CD70 in normal tissues and its widespread expression in various malignancies makes it an attractive target for antibody-based therapeutics. Investigations to exploit CD70 as a cancer target have lead to the identification of potential antibody-based clinical candidates.

Immune Checkpoint
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
CD70 molecule
Research Areas
References
  • Adam PJ, et al. (2006) CD70 (TNFSF7) is expressed at high prevalence in renal cell carcinomas and is rapidly internalised on antibody binding. Br J Cancer. 95(3): 298-306.
  • Keller AM, et al. (2007) Costimulatory ligand CD70 is delivered to the immunological synapse by shared intracellular trafficking with MHC class II molecules. Proc Natl Acad Sci U S A. 104(14): 5989-94.
  • Grewal IS. (2008) CD70 as a therapeutic target in human malignancies. Expert Opin Ther Targets. 12(3): 341-51.
  • Boursalian TE, et al. (2009) Targeting CD70 for human therapeutic use. Adv Exp Med Biol. 647: 108-19.
  • CD70 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD70 cDNA ORF Clone in Cloning Vector, Rhesus CG90089-G
    CD70 cDNA ORF Clone, Rhesus, untagged CG90089-UT
    CD70 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90089-ACGLN
    CD70 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90089-ACG
    CD70 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90089-ACR
    CD70 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90089-CF
    CD70 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90089-NF
    CD70 cDNA ORF Clone, Rhesus, C-His tag CG90089-CH
    CD70 cDNA ORF Clone, Rhesus, N-His tag CG90089-NH
    CD70 cDNA ORF Clone, Rhesus, C-HA tag CG90089-CY
    CD70 cDNA ORF Clone, Rhesus, N-HA tag CG90089-NY
    CD70 cDNA ORF Clone, Rhesus, C-Myc tag CG90089-CM
    CD70 cDNA ORF Clone, Rhesus, N-Myc tag CG90089-NM

    CD70 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD70 cDNA ORF Clone in Cloning Vector, Rat RG80161-G
    CD70 cDNA ORF Clone, Rat, untagged RG80161-UT
    CD70 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80161-ACG
    CD70 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80161-ACGLN
    CD70 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80161-ACR
    CD70 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80161-CF
    CD70 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80161-NF
    CD70 cDNA ORF Clone, Rat, C-His tag RG80161-CH
    CD70 cDNA ORF Clone, Rat, N-His tag RG80161-NH
    CD70 cDNA ORF Clone, Rat, C-HA tag RG80161-CY
    CD70 cDNA ORF Clone, Rat, N-HA tag RG80161-NY
    CD70 cDNA ORF Clone, Rat, C-Myc tag RG80161-CM
    CD70 cDNA ORF Clone, Rat, N-Myc tag RG80161-NM
    CD70 qPCR Primer Pairs, Rat RP300156

    CD70 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD70 cDNA ORF Clone in Cloning Vector, Mouse MG51129-G
    CD70 cDNA ORF Clone, Mouse, untagged MG51129-UT
    CD70 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51129-ACG
    CD70 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51129-ACGLN
    CD70 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51129-ACR
    CD70 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51129-CF
    CD70 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51129-NF
    CD70 cDNA ORF Clone, Mouse, C-His tag MG51129-CH
    CD70 cDNA ORF Clone, Mouse, N-His tag MG51129-NH
    CD70 cDNA ORF Clone, Mouse, C-HA tag MG51129-CY
    CD70 cDNA ORF Clone, Mouse, N-HA tag MG51129-NY
    CD70 cDNA ORF Clone, Mouse, C-Myc tag MG51129-CM
    CD70 cDNA ORF Clone, Mouse, N-Myc tag MG51129-NM

    CD70 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD70 cDNA ORF Clone in Cloning Vector, Human HG10780-M
    CD70 cDNA ORF Clone, Human, untagged HG10780-UT
    CD70 cDNA ORF Clone, Human, C-GFPSpark® tag HG10780-ACG
    CD70 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10780-ACGLN
    CD70 cDNA ORF Clone, Human, C-OFPSpark® tag HG10780-ACR
    CD70 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10780-CF
    CD70 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10780-NF
    CD70 cDNA ORF Clone, Human, C-His tag HG10780-CH
    CD70 cDNA ORF Clone, Human, N-His tag HG10780-NH
    CD70 cDNA ORF Clone, Human, C-HA tag HG10780-CY
    CD70 cDNA ORF Clone, Human, N-HA tag HG10780-NY
    CD70 cDNA ORF Clone, Human, C-Myc tag HG10780-CM
    CD70 cDNA ORF Clone, Human, N-Myc tag HG10780-NM
    CD70 qPCR Primer Pairs, Human HP100698
    info info
    添加购物车成功! 添加购物车失败!