Быстрый заказ

Человек CCL19/MIP-3b Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CCL19 Информация о продукте «Клон cDNA»
Размер кДНК:297bp
Описание кДНК:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 19 with Flag tag.
Синоним гена:ELC, CKb11, MIP3B, MIP-3b, SCYA19, MGC34433
Участок рестрикции:KpnI + XhoI (5.4kb + 0.35kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек CCL19/MIP-3b Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек CCL19/MIP-3b Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10232-ACGRBS15400
Человек CCL19/MIP-3b Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10232-ACRRBS15400
Человек CCL19/MIP-3b Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10232-CFRBS13340
Человек CCL19/MIP-3b Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10232-CHRBS13340
Человек CCL19/MIP-3b Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10232-CMRBS13340
Человек CCL19/MIP-3b Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10232-CYRBS13340
Человек CCL19/MIP-3b Джин клон кДНК в вектор клонированияHG10232-MRBS5130
Человек CCL19/MIP-3b Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10232-M-FRBS13340
Человек CCL19/MIP-3b Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10232-NFRBS13340
Человек CCL19/MIP-3b Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10232-NHRBS13340
Человек CCL19/MIP-3b Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10232-NMRBS13340
Человек CCL19/MIP-3b Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10232-NYRBS13340
Человек CCL19/MIP-3b Джин ORF экспрессии кДНК клона плазмидыHG10232-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10232-M-F
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.