After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CCL17/TARC Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CCL17 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002987.2
Размер кДНК:285bp
Описание кДНК:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 17 with Flag tag.
Синоним гена:TARC, ABCD-2, SCYA17, A-152E5.3, MGC138271, MGC138273
Виды:Human
переносчик:pCMV2-FLAG
Plasmid:pCMV2-CCL17-flag
Участок рестрикции:HindIII + XbaI (5.4kb + 0.34kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
 
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек CCL17/TARC Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек CCL17/TARC Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10233-ACGRBS15400
Человек CCL17/TARC Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10233-ACRRBS15400
Человек CCL17/TARC Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10233-CFRBS13340
Человек CCL17/TARC Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10233-CHRBS13340
Человек CCL17/TARC Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10233-CMRBS13340
Человек CCL17/TARC Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10233-CYRBS13340
Человек CCL17/TARC Джин клон кДНК в вектор клонированияHG10233-MRBS5130
Человек CCL17/TARC Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10233-M-FRBS13340
Человек CCL17/TARC Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10233-NFRBS13340
Человек CCL17/TARC Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10233-NHRBS13340
Человек CCL17/TARC Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10233-NMRBS13340
Человек CCL17/TARC Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10233-NYRBS13340
Человек CCL17/TARC Джин ORF экспрессии кДНК клона плазмидыHG10233-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the same structure similarities such as small size, and the presence of four cysteine residues in conserved locations in order to form their 3-dimensional shape. Some of the chemokines are considered pro-inflammatory which can be induced to recruit cells of the immune system to a site of infection during an immune response, while others are considered homeostatic and are implied in controlling the migration of cells during normal processes of tissue maintenance and development. There are four members of the chemokine family: C-C kemokines, C kemokines, CXC kemokines and CX3C kemokines. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands-1 to 28. Chemokin ligand 17 (CCL17), also known as thymus and activation regulated chemokine(TARC), is a small cytokine belonging to the C-C chemokine family. CCL17 is expressed maily in thymus and transiently in phytohemagglutinin-stimulated peripheral blood mononuclear cells. CCL17 can induce chemotaxis in T cells by binding with the chemokine receptor CCR4.

Ссылки
  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28(5): 443-60.
  • Cocchi F, et al. (1995) Identification of RANTES, MIP-1a, and MIP-1b as the major HIV-suppressive factor produced by CD8+ T cells. Science. 270 (5243): 1811-5.
  • Morita A, et al. (2002). Evaluation of human thymus and activation-regulated chemokine concentrations in blood using a new sandwich ELISA based on monoclonal antibodies. Clin Chim Acta. 322 (1-2): 67-75.
  • Size / Price
    Каталог: HG10233-M-F
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».