BTN3A3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

BTN3A3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1755 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens butyrophilin, subfamily 3, member A3.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

BTN3A3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

BTF3 cDNA ORF Clone, Human; BTN3.3 cDNA ORF Clone, Human; BTN3A3 cDNA ORF Clone, Human

BTN3A3 Background Information

The three butyrophilin BTN3A molecules, BTN3A1, BTN3A2, and BTN3A3, are members of the B7/butyrophilin-like group of Ig superfamily receptors, which modulate the function of T cells. The butyrophilin 3 (BTN3) receptors are implicated in the T lymphocytes regulation and present a wide plasticity in mammals. A thorough phylogenetic analysis reveals a concerted evolution of BTN3 characterized by a strong and recurrent homogenization of the region encoding the signal peptide and the immunoglobulin variable (IgV) domain in Hominoids, where the sequences of BTN3A1 or BTN3A3 are replaced by BTN3A2 sequence.
Full Name
butyrophilin subfamily 3 member A3
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait